Application
시금치에서 살아있는 대장균 및 재조합 DNA의 추출
샘플 준비
작성일
2024-12-04 15:03
Evaluation of sample disruption techniques for high-throughput extraction of live Escherichia coli and recombinant DNA from spinach.
Eric Clouser, Revvity, Inc.
Introduction
식품에서 병원균을 검출하고 그 리스트를 검토하는 것은 식품 안전을 보장하는 데 매우 중요합니다.
정부 기관과 식품 회사는 오염 위험을 평가하기 위해 미생물학적 분석을 사용합니다.
기존의 검출 방법에는 배양과 생화학적 식별이 포함되는데, 이는 비용 효율적이지만 최대 1주일이 소요될 수 있습니다.
이에 비해 PCR 방법은 신속하고 민감하며 특정 병원체를 검출할 수 있습니다.
최근 비드 밀 기술의 발전으로 작은 비드를 고속으로 흔들어 처리 시간을 단축하여 샘플 균질화의 효율성이 크게 향상되었습니다.
이 방법을 PCR과 결합하면 샘플을 더 빠르게 처리하고 배양할 필요가 없어 검사 속도가 빨라집니다.
여기서는 시금치 샘플에 녹색 형광 단백질(GFP)을 발현하는 알려진 수준의 재조합 대장균을 연속적으로 희석하여 접종하고, 비드 밀과 로터-스테이터 균질화기를 모두 사용하여 처리했습니다.
표준 플레이트 카운트를 통해 살아 있는 세포의 회수율을 평가하고 PCR 증폭을 통해 두 방법의 검출 한계를 분석했습니다.
Materials and Methods
Transformation:
Competent DH5 alpha E. coli cells were transformed with the pGLO plasmid containing the GFP gene.
The cells were spread onto LB/Amp/Ara plates and later observed under UV light for detection recombinant colonies.
Two recombinant colonies were inoculated into two separate LB/AMP broth cultures and incubated overnight at 37 °C.
Dilutions and processing:
After incubation, each culture was serial diluted by the following dilution factors 1x10-2 , 1x10-4 , 1x10-5 , 5x10-6 , 2.5x10-6 and 1x10 -6 to produce twelve total control colonies.
~5 g of store-bought spinach was added to each dilution (total 12 inoculums).
Prior to processing, 100 μL of control dilutions 1x10-5 and 1x10-6 were plated on LB/Amp/Ara plates to confirm colony count.
Six spinach inoculums (1x10-2 to 1x10-6 ) were disrupted on the Omni Tissue Homogenizer (TH) rotor-stator homogenizer with Omni Hard Tissue tips for 1 minute at medium speed and the other six spinach inoculums (1x10-2 to 1x10-6 ) were disrupted on the Omni Bead Ruptor Elite bead mill homogenizer at 4 m/s for 30 s in a 30 mL tube containing 6.3 g of 2.8 mm ceramic beads.
After processing, 100 μL of each spinach homogenate was plated on LB/AMP/Ara plates.
All plates were grown over night at 37 °C and counted to determine the number of viable recombinant colonies.
pGLO extraction:
The pGLO plasmid was extracted from each of the twelve spinach homogenates using a commerciallyavailable bacterial DNA extraction kit.
The DNA concentrations of each dilution was analyzed using a NanoDrop Spectrophotometer.
GFP gene detection: 5 ng of each of the twelve spinach homogenates were amplified using the below primers.
These primers are designed to amplify 99.2% of the GFP gene.
Table 1. Primers
Table 2: PCR program
Table 2: PCR program
Amplifications were performed using the T100 Thermal Cycler by Bio-Rad.
PCR products were analyzed on a 2% agarose gel and stained using ethidium bromide. Spot volume intensities were analyzed via Bio-Rad’s Gel DOC EZ Software.

Results
Live cell recovery and viability:
Bead mill and rotor-stator homogenize는 강력한 기계적 균질화 장치로 다양한 시료 유형을 강력하게 균질화 할 수 있습니다.
여기에서는 접종된 식품을 처리하여 미생물의 생존력을 유지하면서 균질화를 완료했습니다.
세포 생존율과 회복률을 처리하지 않은 대조군과 비교했습니다.
재조합 GFP 콜로니는 자외선 아래에서 녹색으로 형광을 발합니다.
2종류의 장비 모두 시금치 샘플을 완전히 처리하는 동시에 생존 가능한 세포를 유지합니다.
각 처리 기술을 통해 대조군과 비슷한 양의 재조합 콜로니를 회수하였습니다.


Level of detection:
처리 후 end-point PCR 을 통해 pGLO 플라스미드를 추출하고 검출했습니다.
pGLO 플라스미드의 예상 크기는 714bp로 나타났습니다.
겔 전기영동을 통해 증폭 후 검출한계를 분석했습니다.
스팟 강도의 감소는 CFUs의 감소와 함께 나타났습니다.


Spot volume intensities:
스팟 볼륨 강도는 Gel Doc EZ 소프트웨어(Bio-Rad)를 통해 분석했습니다.
모든 대역을 감지하고 분석할 수 있도록 감도를 조정했습니다.
Spot Volume to CFU Analysis:
CFU 수는 값의 로그2를 취하고 각 희석 샘플의 젤 스팟 부피에 대해 플로팅하여 분석했습니다.
가장 잘 맞는 선형 곡선이 적용되었습니다.
값이 선형이어서 검출된 앰플리코의 양과 CFU 수 사이에 상관관계가 있음을 알 수 있습니다.


Conclusions
1.Omni Bead Ruptor Elite and the Omni Tissue Homogenizer (TH)는 모두 surface bacteria를 파괴하지 않고 시금치를 완전히 균질화 할 수 있습니다.
2.두 방법 모두 76%의 세포 회수율과 1x10- CFU/mL의 PCR 검출 한계를 제공했습니다.
3.PCR을 통해 증폭된 DNA의 양에 대한 CFU 수 사이에 선형 관계가 입증되었으며, 특히 낮은 CFU 한계에서 더 뚜렷하게 나타났습니다.
4. 두 듄질화 장비의 강력한 균질화 능력은 잠재적으로 사전 농축 단계를 필요 없게 하여 병원체 검출을 절반의 시간 안에 완료할 수 있게 합니다.
Equipments
• Bead Ruptor Elite (Cat # 19-042E)
• TH homogenizer (Cat # TH220)
• 2mL Hard Tissue Homogenizing Mix (Cat # 19-628)
Tags
Bead Ruptor, BR elite, spinach, DNA, 병원체, PCR, homogenizer, E.Coli
Eric Clouser, Revvity, Inc.
Introduction
식품에서 병원균을 검출하고 그 리스트를 검토하는 것은 식품 안전을 보장하는 데 매우 중요합니다.
정부 기관과 식품 회사는 오염 위험을 평가하기 위해 미생물학적 분석을 사용합니다.
기존의 검출 방법에는 배양과 생화학적 식별이 포함되는데, 이는 비용 효율적이지만 최대 1주일이 소요될 수 있습니다.
이에 비해 PCR 방법은 신속하고 민감하며 특정 병원체를 검출할 수 있습니다.
최근 비드 밀 기술의 발전으로 작은 비드를 고속으로 흔들어 처리 시간을 단축하여 샘플 균질화의 효율성이 크게 향상되었습니다.
이 방법을 PCR과 결합하면 샘플을 더 빠르게 처리하고 배양할 필요가 없어 검사 속도가 빨라집니다.
여기서는 시금치 샘플에 녹색 형광 단백질(GFP)을 발현하는 알려진 수준의 재조합 대장균을 연속적으로 희석하여 접종하고, 비드 밀과 로터-스테이터 균질화기를 모두 사용하여 처리했습니다.
표준 플레이트 카운트를 통해 살아 있는 세포의 회수율을 평가하고 PCR 증폭을 통해 두 방법의 검출 한계를 분석했습니다.
Materials and Methods
Transformation:
Competent DH5 alpha E. coli cells were transformed with the pGLO plasmid containing the GFP gene.
The cells were spread onto LB/Amp/Ara plates and later observed under UV light for detection recombinant colonies.
Two recombinant colonies were inoculated into two separate LB/AMP broth cultures and incubated overnight at 37 °C.
Dilutions and processing:
After incubation, each culture was serial diluted by the following dilution factors 1x10-2 , 1x10-4 , 1x10-5 , 5x10-6 , 2.5x10-6 and 1x10 -6 to produce twelve total control colonies.
~5 g of store-bought spinach was added to each dilution (total 12 inoculums).
Prior to processing, 100 μL of control dilutions 1x10-5 and 1x10-6 were plated on LB/Amp/Ara plates to confirm colony count.
Six spinach inoculums (1x10-2 to 1x10-6 ) were disrupted on the Omni Tissue Homogenizer (TH) rotor-stator homogenizer with Omni Hard Tissue tips for 1 minute at medium speed and the other six spinach inoculums (1x10-2 to 1x10-6 ) were disrupted on the Omni Bead Ruptor Elite bead mill homogenizer at 4 m/s for 30 s in a 30 mL tube containing 6.3 g of 2.8 mm ceramic beads.
After processing, 100 μL of each spinach homogenate was plated on LB/AMP/Ara plates.
All plates were grown over night at 37 °C and counted to determine the number of viable recombinant colonies.
pGLO extraction:
The pGLO plasmid was extracted from each of the twelve spinach homogenates using a commerciallyavailable bacterial DNA extraction kit.
The DNA concentrations of each dilution was analyzed using a NanoDrop Spectrophotometer.
GFP gene detection: 5 ng of each of the twelve spinach homogenates were amplified using the below primers.
These primers are designed to amplify 99.2% of the GFP gene.
Table 1. Primers
| Instruments | Sequence | |
| GFP-F | 5‘ - ATGGCTAGCAAAGGAGAAGAA - 3’ | |
| GFP-R | 5’ - GTAGAGCTCATCCATGCCATGTG - 3’ |
Table 2: PCR program
| Instruments | Sequence | |
| Hot start/denaturation | 95 | 120 |
| 30 cycles | 95 59 72 |
30 30 60 |
| Final extension | 72 | 5min |
Table 2: PCR program
Amplifications were performed using the T100 Thermal Cycler by Bio-Rad.
PCR products were analyzed on a 2% agarose gel and stained using ethidium bromide. Spot volume intensities were analyzed via Bio-Rad’s Gel DOC EZ Software.

Results
Live cell recovery and viability:
Bead mill and rotor-stator homogenize는 강력한 기계적 균질화 장치로 다양한 시료 유형을 강력하게 균질화 할 수 있습니다.
여기에서는 접종된 식품을 처리하여 미생물의 생존력을 유지하면서 균질화를 완료했습니다.
세포 생존율과 회복률을 처리하지 않은 대조군과 비교했습니다.
재조합 GFP 콜로니는 자외선 아래에서 녹색으로 형광을 발합니다.
2종류의 장비 모두 시금치 샘플을 완전히 처리하는 동시에 생존 가능한 세포를 유지합니다.
각 처리 기술을 통해 대조군과 비슷한 양의 재조합 콜로니를 회수하였습니다.


Level of detection:
처리 후 end-point PCR 을 통해 pGLO 플라스미드를 추출하고 검출했습니다.
pGLO 플라스미드의 예상 크기는 714bp로 나타났습니다.
겔 전기영동을 통해 증폭 후 검출한계를 분석했습니다.
스팟 강도의 감소는 CFUs의 감소와 함께 나타났습니다.


Spot volume intensities:
스팟 볼륨 강도는 Gel Doc EZ 소프트웨어(Bio-Rad)를 통해 분석했습니다.
모든 대역을 감지하고 분석할 수 있도록 감도를 조정했습니다.
| Dilution | Rotor-stator spot volume (int) | Bead mill spot volume (int) |
| 1 x 10-2 | 1,246,320 | 1,554,420 |
| 1 x 10-4 | 273,300 | 155,220 |
| 1 x 10-5 | 125,880 | 58,230 |
| 5 x 10-6 | 39,870 | 52,080 |
| 2.5 x 10-6 | 51,960 | 41,730 |
| 1 x 10-6 | 37,200 | 23,820 |
CFU 수는 값의 로그2를 취하고 각 희석 샘플의 젤 스팟 부피에 대해 플로팅하여 분석했습니다.
가장 잘 맞는 선형 곡선이 적용되었습니다.
값이 선형이어서 검출된 앰플리코의 양과 CFU 수 사이에 상관관계가 있음을 알 수 있습니다.


Conclusions
1.Omni Bead Ruptor Elite and the Omni Tissue Homogenizer (TH)는 모두 surface bacteria를 파괴하지 않고 시금치를 완전히 균질화 할 수 있습니다.
2.두 방법 모두 76%의 세포 회수율과 1x10- CFU/mL의 PCR 검출 한계를 제공했습니다.
3.PCR을 통해 증폭된 DNA의 양에 대한 CFU 수 사이에 선형 관계가 입증되었으며, 특히 낮은 CFU 한계에서 더 뚜렷하게 나타났습니다.
4. 두 듄질화 장비의 강력한 균질화 능력은 잠재적으로 사전 농축 단계를 필요 없게 하여 병원체 검출을 절반의 시간 안에 완료할 수 있게 합니다.
Equipments
• Bead Ruptor Elite (Cat # 19-042E)
• TH homogenizer (Cat # TH220)
• 2mL Hard Tissue Homogenizing Mix (Cat # 19-628)
![]() |
![]() |
![]() |
![]() |
Tags
Bead Ruptor, BR elite, spinach, DNA, 병원체, PCR, homogenizer, E.Coli
전체 0








