Application
Rare mutation detection using Clarity Digital PCR
Digital PCR
작성일
2022-01-13 17:43
극단적으로 낮은 수준으로 발현되는 rare mutant의 감지를 위한 최고의 접근법
Rare mutation detection using Clarity Digital PCR
Overview
BRAF 종양유전자의 돌연변이는 악성 흑색종, 유두 갑상선, 대장암과 같은 수많은 human cancer와 관련이 있는 것으로 나타난다.
따라서 임상 반응과 생존율을 향상시키는 BRAF inhibitors를 사용하는 표적 암 치료의 바이오마커 역할을 하기 때문에 높은 민감도를 가진 V600E allele의 검출이 중요하다고 할 수 있다.
여기서는 Clarity digital PCR system을 BRAF V600E 희귀 돌연변이 검출을 위한 유용한 도구로 사용하는 방법에 대해 설명한다.
Clarity digital PCR system detected less than 0.001% of V600E mutant allele
BRAF V600E mutant fractions은 정제된 HT-29 cell line DNA와 wild-type human DNA(Promega)를 혼합하여 작성되었다.
이 fractionduplex Taqman assay를 통해 분석한 후 각 반응 혼합물은 Clarity tube strip을 사용하여 약 10,000개의 파티션으로 세분되었다.
이어서 PCR과 Clarity reader를 이용한 데이터 감지가 이루어졌다.
표 1과 같이 Clarity는 0.0007%의 돌연변이 DNA를 검출했다.
데이터가 예상 mutant fractions에 대한 결과는 0.9989의 R2 값과 강한 선형 관계를 보여주었다 (그림 1).
Table 1. Results of BRAF V600E mutant detection using Clarity digital PCR system.
All experiments were performed in triplicates with 9 no-template controls.
The HT-29 mutant cell line harbors 30% V600E mutation, as measured by the Clarity system (data not shown).
Table 2. List of primers and probes used in the duplex assay.
Underlined nucleotide in mutant probe sequence corresponds to the mutation site
Figure 1. The plot of the measured V600E mutant fraction against its expected mutant fraction

Conclusion
야생형 대립 유전자의 background에서 희귀 돌연변이 표적을 감지하려면 고도의 민감도가 필요하다.
Real-time PCR과 같은 기존의 방법은 일반적으로 최적화된 분석으로 1%의 돌연변이 DNA만 검출할 수 있었다.
따라서 극도로 낮은 수준의 돌연변이를 검출하기 위해 더 높은 민감도를 가진 새로운 접근법의 이용이 바람직하다.
본 연구에서는 Clarity digital PCR이 Real-time PCR보다 1,000배 더 민감한, 매우 낮은 수준의 BRAF V600E 돌연변이를 검출할 수 있음을 입증했다.
희귀 돌연변이 allele를 발견하는 이러한 접근은 암 진단, 예후 및 치료 옵션을 지원하는 데 귀중한 역할을 할 것으로 기대된다.
Exclusive Kit for Clarity system
References
1. Cantwell-Dorris ER, O'Leary JJ and Sheils OM (2011) BRAF V600E: implications for carcinogenesis and molecular therapy. Mol Cancer Ther. 10(3):385-94
2. Kwong LN, Davies MA. (2014) Targeted therapy for melanoma: rational combinatorial approaches. Oncogene. 33(1):1-9
Equipment
Clarity Plus Digital PCR system 상세보기

• 절대 정량
• 샘플 손실 최소화
• 정확성 향상
• 빠른 처리 시간
• 연구자만의 분석 방법 설계 가능
Application
• Cell-free nucleic acid analysis
• Quantification reference materials
• Copy number variant analysis
• Bacterial / Viral load quantification
• Next-generation sequencing (NGS) applications
• Minimum Sample Loss
• Fast Turnaround Time
• Ability to design your own assay
• SNP quantification
• Rare variant detections
• Genomic alterations
• Gene expression analysis
• Digital PCR assay customization
Tags
#digital_PCR, #dPCR, #qPCR, #유전자, #유전자증폭, #clarity, #real-time PCR, #CNV , #DGE , #mutation #돌연변이 #대립유전자
Rare mutation detection using Clarity Digital PCR
Overview
BRAF 종양유전자의 돌연변이는 악성 흑색종, 유두 갑상선, 대장암과 같은 수많은 human cancer와 관련이 있는 것으로 나타난다.
따라서 임상 반응과 생존율을 향상시키는 BRAF inhibitors를 사용하는 표적 암 치료의 바이오마커 역할을 하기 때문에 높은 민감도를 가진 V600E allele의 검출이 중요하다고 할 수 있다.
여기서는 Clarity digital PCR system을 BRAF V600E 희귀 돌연변이 검출을 위한 유용한 도구로 사용하는 방법에 대해 설명한다.
Clarity digital PCR system detected less than 0.001% of V600E mutant allele
BRAF V600E mutant fractions은 정제된 HT-29 cell line DNA와 wild-type human DNA(Promega)를 혼합하여 작성되었다.
이 fractionduplex Taqman assay를 통해 분석한 후 각 반응 혼합물은 Clarity tube strip을 사용하여 약 10,000개의 파티션으로 세분되었다.
이어서 PCR과 Clarity reader를 이용한 데이터 감지가 이루어졌다.
표 1과 같이 Clarity는 0.0007%의 돌연변이 DNA를 검출했다.
데이터가 예상 mutant fractions에 대한 결과는 0.9989의 R2 값과 강한 선형 관계를 보여주었다 (그림 1).
Table 1. Results of BRAF V600E mutant detection using Clarity digital PCR system.
All experiments were performed in triplicates with 9 no-template controls.
The HT-29 mutant cell line harbors 30% V600E mutation, as measured by the Clarity system (data not shown).
Expected Mutant Fraction (%) |
Mutant (FAM Assay) | Wildtype (VIC Assay) | Measured Mutant Fraction (%) |
||
Measured Concentration (copies/µL) |
Relative Uncertainty (%) |
Measured Concentration (copies/µL) |
Relative Uncertainty (%) |
||
1 | 19.24 | 3.33 | 2533 | 1.51 | 0.7540 |
0.1 | 2.6 | 5.22 | 2670 | 3.57 | 0.0973 |
0.01 | 0.21 | 1.13 | 2661 | 1.00 | 0.0079 |
0.001 | 0.02 | 86.6 | 2700 | 1.00 | 0.00074 |
0 | 0 | - | 2566 | 0.67 | 0 |
Table 2. List of primers and probes used in the duplex assay.
Underlined nucleotide in mutant probe sequence corresponds to the mutation site
Oligonucleotide | Sequence (5’-3’) |
Forward primer | TACTGTTTTCCTTTACTTACTACACCTCAGA |
Reverse primer | ATCCAGACAACTGTTCAAACTGATG |
Mutant probe (FAM) | TAGCTACAGAGAAATC |
Wild-type probe (VIC) | CTAGCTACAGTGAAATC |
Figure 1. The plot of the measured V600E mutant fraction against its expected mutant fraction
Conclusion
야생형 대립 유전자의 background에서 희귀 돌연변이 표적을 감지하려면 고도의 민감도가 필요하다.
Real-time PCR과 같은 기존의 방법은 일반적으로 최적화된 분석으로 1%의 돌연변이 DNA만 검출할 수 있었다.
따라서 극도로 낮은 수준의 돌연변이를 검출하기 위해 더 높은 민감도를 가진 새로운 접근법의 이용이 바람직하다.
본 연구에서는 Clarity digital PCR이 Real-time PCR보다 1,000배 더 민감한, 매우 낮은 수준의 BRAF V600E 돌연변이를 검출할 수 있음을 입증했다.
희귀 돌연변이 allele를 발견하는 이러한 접근은 암 진단, 예후 및 치료 옵션을 지원하는 데 귀중한 역할을 할 것으로 기대된다.
Exclusive Kit for Clarity system
10016 | EGFR T790M mutation Quantification kit |
폐암 EGFR |
T790M mutation DNA의 정확한 정량 0.1% 이하의 T790M mutant DNA도 검출 |
10017 | Epstein-Barr virus Quantification kit |
악성 림프종 EBV |
EBV 특이적 DNA의 정확한 정량 0.5 copy/µL sample 이하의 DNA 검출 |
10018 | Hepatitis B virus Quantification kit |
B형간염 HBV |
모든 타입(8)의 HBV genotypes의 정확한 정량 0.5 copy/µL reaction 이하의 DNA 검출 |
References
1. Cantwell-Dorris ER, O'Leary JJ and Sheils OM (2011) BRAF V600E: implications for carcinogenesis and molecular therapy. Mol Cancer Ther. 10(3):385-94
2. Kwong LN, Davies MA. (2014) Targeted therapy for melanoma: rational combinatorial approaches. Oncogene. 33(1):1-9
Equipment
Clarity Plus Digital PCR system 상세보기

• 절대 정량
• 샘플 손실 최소화
• 정확성 향상
• 빠른 처리 시간
• 연구자만의 분석 방법 설계 가능
Application
• Cell-free nucleic acid analysis
• Quantification reference materials
• Copy number variant analysis
• Bacterial / Viral load quantification
• Next-generation sequencing (NGS) applications
• Minimum Sample Loss
• Fast Turnaround Time
• Ability to design your own assay
• SNP quantification
• Rare variant detections
• Genomic alterations
• Gene expression analysis
• Digital PCR assay customization
Tags
#digital_PCR, #dPCR, #qPCR, #유전자, #유전자증폭, #clarity, #real-time PCR, #CNV , #DGE , #mutation #돌연변이 #대립유전자
전체 0