Application

SARS-CoV-2 & winter viruses 검출을 위한 multiplex probe 1-step RT-qPCR

qPCR assay
작성일
2021-12-03 16:51
A test panel for SARS-CoV-2 & winter viruses using multiplex probe 1-step RT-qPCR
by Matteo Beretta Ph.D. & Constantine Garagounis Ph.D.

Introduction
Winter virus는 신종 SARS-CoV-2 바이러스와 결합하면 진단이 어려워진다.
따라서 이러한 병원균을 잘 검출하는 것은 적절한 치료 및 보호 격리 조치를 취하기 위해 매우 중요하다.
바이러스 변종 식별의 기본적인 방법은 전체 바이러스 게놈 염기서열 분석 또는 특정 변종의 주요 바이러스 유전자의 염기서열 분석이다.
그러나 시퀀싱을 통한 접근은 시간과 노력이 많이 든다. 따라서 RT-qPCR에 의한 신속한 검진이 선호되는 추세이며 전체 진단을 위해 필요할 때 시퀀싱을 진행할 수 있다.
RT-qPCR은 핵산 표적 검출 및 정량화를 위한 벤치마크 기술로, 매우 짧은 시간 내에 여러 샘플과 표적을 신뢰성 있게 분석할 수 있다.
일반적인 40 cycle 정도의 RT-qPCR 은 샘플 준비 시간 15~30분과 PCR 장비의 즉각적인 분석 과정을 고려하여 보통 3시간 이내에 완료 가능하다.

여러 RT-qPCR 프로토콜을 사용하여 다양한 Winter virus를 탐지할 수 있다.
그러나 가장 좋은 접근법 중 하나는 일반적인 병원성 바이러스 변종을 검출하기 위해 multiplex RT-qPCR을 사용하는 것이다.
멀티플렉싱은 시간과 시약, 장비를 효율적으로 활용하면서 동시에 여러 타겟에 대한 테스트가 가능하기 때문이다.
따라서 high-capacity diagnostic workflow에 이상적이다.
multiplex RT-qPCR은 샘플과 함께 검출되는 모든 대상에 대한 primer pair와 특이적인 probe를 single reaction mix에서 혼합함으로써 수행한다.
각 probe는 고유한 형광물질로 레벨링되어 thermocycling 중에 고유한 형광 신호를 내놓게 된다.
그래서 단일 샘플로 한 번의 반응에서 여러 표적에 대해 분석할 수 있다.

여기서는 일반적인 Winter virus (Influenza A virus, Influenza B virus, human Respiratory Syncytial Virus A2, and the novel SARS-CoV-2 virus)로 구성된 winter panel에 대한 신뢰할만한 빠른 (최대 1.5시간) 멀티플렉스 검사를 설명한다.
우리는 이러한 winter panel의 사용이 현재 유행병 이후에도 보편화될 것으로 예상하며, 이러한 일반적이고 반복적인 병원체에 대한 능률적인 진단 테스트를 가능하게 하기 위해 이 분석법을 설계했다.

Method
우리는 SARSCoV-2를 포함하는 Winter virus panel을 탐지하기 위한 프로토콜을 WHO와 CDC의 리포트를 참고하여 수립했다(표1).
PCRbiosystem사의 Probe 1-Step Virus Detect를 프로토콜의 RT-qPCR master mix로 사용했으며 test template은 RNA viral sequences 였고 각 바이러스의 target sequence는 Matrix protein M1 gene of the Influenza A virus, Hemagglutinin gene of the Influenza B virus, Matrix protein gene of human Respiratory Syncytial Virus A2, E-gene of the SARS-CoV-2 virus (표1) 이었다.
다양한 조건을 분석한 후 이러한 바이러스의 검출을 위해 최적화된 multiplex RT-qPCR protocol을 제시한다.

Name Dye-Sequence Con. Template Target
InfA-F GACCRATCCTGTCACCTCTGAC nM Influenza virus A, A/Virginia/ATCC1/2009 (H1N1).
ATCC-VR-1736DQ. Lot 70029949.
Matrix Protein M1 gene
InfA-R AGGGCATTYTGGACAAAKCGTCTA nM
InfA-P HEX-TGCAGTCCTCGCTCACTGGGCACG-BHQ1 nM
InfB-F AAATACGGTGGATTAAATAAAAGCAA nM Influenza virus B, B/Wisconsin/1/2020 BX-41A. ATCC-VR-1885DQ.
Lot 70034872.
Hemagglutinin gene
InfB-R CCAGCAATAGCTCCGAAGAAA nM
InfB-P Cy5-CACCCATATTGGGCAATTTCCTATGGC-BHQ2 nM
RSV-F GCAAATATGGAAACATACGTGAACA nM Respiratory Syncytial Virus,
ATCC-VR-1540DQ,
Lot 70027617
Matrix Protein gene
RSV-R GCACCCATATTGTWAGTGATGCA nM
RSV-P Tex615-CTTCACGAAGGCTCCACATACACAGCWG-BHQ2 nM
E_Sarbeco-F ACAGGTACGTTAATAGTTAATAGCGT nM SARS-CoV-2,
ATCC-VR-3276SD.
Envelope (E) gene
E_Sarbeco-R ATATTGCAGCAGTACGCACACA nM
E_Sarbeco-B FAM-ACACTAGCCATCCTTACTGCGCTTCG-BHQ1 nM

Table 1: Primers, probes, and targets used.

Primer and template preparation
각 타켓마다 400μL 10μM primer (F+R)와 200μL 10μM probe (이는 20μL reaction mix마다 0.8 μL 10 μM primer F+R과 0.4 μL의 10 μM probe를 첨가하는 것과 같다)를 혼합하여 프라이머 세트를 준비하였다.
템플릿은 검체당 40,000 copy 부터 4 copy까지 연속적으로 10배씩 5번 희석하여 준비하였다. 각 타겟에는 No template control samples (NTCs)이 비교를 위해 포함되었다.

Reaction setup
반응은 QIAgility robot을 사용하여 최종 20μL 로 맞추어 수행되었다.
(4.2μL Milli-Q water, 5μL 4x qPCRBIO Probe 1-Step Virus Detect, 1μL 20x UltraScript RTase, 1.2μL x 4 primers/probe mix and 5μL of pooled RNA sample).
표 2는 추가된 성분의 최종 농도를 요약한 것이다.

Reagent Volume Final conc.
20x UltraScript RTase 1μL 1x
4x PCRBIO Probe 1-Step Virus Detect 5μL 1x
Primer mix (10μM) 0.8μL 400nM
Probe (10μM) 0.4μL 200nM
RNA template 5μL Variable
PCR grade dH2O 4.52μL

Table 2: Reaction setup and composition

Cycling conditions
Thermocycling 표3에 요약된 cycling parameters를 사용하여 CFX96을 통해 각 cycle 마다 형광 값을 측정하였다.

Cycles Temp. Time Notes
1 45°C 20 minutes Reverse transcription
1 95°C 3 minutes Polymerase activation and RTase inactivation
50 95°C
60°C
15 seconds
30 seconds

Denaturation
Annealing/Extension

Table 3: Cycling conditions
Results
최저 농도(4 copy/20μL reaction)에서도 40 cycle전에 모든 타겟이 성공적으로 검출되었다. (그림 1 및 표 4).
모든 타텟에 대한 효율성은 90-110% 사이였으며 모든 경우에 R2값이 98% 이상이었다.
모든 타겟에 대한 평균 ±SD target Ct values는 최고 농도 (반응당 40,000 copy) 및 최저 농도(반응당 4 copy)에서 각각 24.13±1.02 및 37.30±1.18이었다.



Figure 1: Fourplex detection of Influenza A, Influenza B, Respiratory syncytial, and SARS-CoV-2 viruses
Four-plex amplification of Influenza A, Influenza B, Respiratory syncytial, and SARS-CoV-2 viruses genes using qPCRBIO Probe 1-Step Virus Detect in quadruplicate.
Amplification curves are shown on the left and efficiency on the right. 5 serial dilutions of synthetic viral RNA template were used, corresponding to 40,000, 4,000,
400, 40 and 4 copies of the SARS-CoV-2 genome. The total reaction volume was 20µL. The InfA probe was labeled with Hex, the InfB probe with Cy5, the RSV probe
with Texas Red, and the SARS-CoV-2 E-gene probe labeled with FAM. Cycling conditions were reverse transcription at 45°C for 10 min, denaturation at 95°C 3 min
and 50 cycles of amplification at 95°C 15s, 60°C 30s.


HEX - Influenza A Cy5 - Influenza B Texas 615 - Respiratory Syncytial Virus FAM - SARS-CoV-2
RNA copies Mean Ct SD Ct n Mean Ct SD Ct n Mean Ct SD Ct n Mean Ct SD Ct n
40,000 25.71 0.07 4 23.12 0.08 4 23.32 0.06 4 24.36 0.03 4
4,000 29.15 0.01 4 26.82 0.16 4 26.71 0.10 4 27.72 0.05 4
400 32.62 0.14 4 30.41 0.26 4 30.26 0.09 4 31.11 0.20 4
40 36.09 0.10 4 33.92 0.86 4 33.63 0.15 4 34.72 0.36 4
4 39.14 0.86 4 35.91 0.57 3 37.34 0.81 4 36.81 0.64 3
NTC N.D. N.A. N.A. N.D. N.A. N.A. N.D. N.A. N.A. N.D. N.A. N.A.
Table 4: Mean Ct and standard deviation values for all samples in the qRT-PCR described in Figure 1.

Discussion
우리의 접근 방식은 4plex RT-qPCR 반응(20μL 반응당 4copy)에서 매우 적은 양의 바이러스 표적을 검출하는 데 성공하는 것으로 입증되었다.
이것은 하나의 test tube에서 3가지 일반적인 winter virus와 새로운 SARS-CoV-2에 대한 빠르고 안정적인 테스트 수단을 제공한다.
핵산 표적에 대한 양성 결과가 반드시 viable viral particles의 존재를 반영하는 것은 아니지만, RT-qPCR 접근법은 병원체 검출 및 정량화를 위한 벤치마크 방법으로 남아 있으며 많은 임상 및 연구 진단 절차의 필수적인 부분이다.
또한 이러한 결과는 multiplex RT-qPCR의 파워와 효율성을 말애주며, 이러한 맥락에서 추가 타켓이 이 패널에 포함될 수 있음을 아는 것이 중요하다.
병원성 바이러스 탐지를 위한 Ten-plex RT-qPCR assays 는 성공적이었다.
이는 특정 SARS-CoV-2 변종의 탐색을 위해서도 현재 애플리케이션이 활용될 수 있음을 의미한다.

이 글을 쓰는 시점에서, COVID-19에 대한 백신 접종과 다른 예방 조치를 취했음에도 불구하고 SARS-CoV-2에 대한 우려의 변종들의 지속적인 출현은 우리가 전염병에서 벗어나는 데 걸림돌이 되고 있다.
따라서 다른 일반적인 바이러스 외에도 다양한 코로나바이러스 변이에 대해 환자를 선별하는 것이 중요하게 되었다.
ECDC (European Centers for Disease Prevention and Control) 지침은 SARS-CoV-2 변이체 식별을 위해 전체 바이러스 게놈 시퀀싱 또는 S-유전자의 전체 Sanger 시퀀싱을 요구하고 있다.
그러나 이러한 접근 방식은 힘들고 시간이 많이 걸리기 때문에 RT-qPCR을 통해 SARS-CoV-2에 대한 샘플을 사전 선별하는 것도 권장된다.
RT-qPCR은 시퀀싱해야 하는 샘플의 총 수를 줄이고 코로나바이러스 변이체 식별에 대해 더 저렴하면서 빠르고, 높은 처리량을 보여주는 방식이다.

변이체 스크리닝을 위해 ECDC에서 권장하는 RT-qPCR 접근 방식은 다음과 같다.

• SARS-CoV-2 S-gene drop-out or target failure, caused by mutation or loss of the primer binding region, in multiplex RT-qPCR targeting multiple SARS-CoV-2 genes.
• Probe-based RT-qPCR with distinct probes and controls for each target variant SNP

적절한 promer와 probe가 선택된다면 이 두 가지 분석 모두 이 애플리케이션 노트에 따라 수행할 수 있다.

PCRbiosystems의 qPCRBIO Probe 1-Step Virus Detect는 새로운 multiplex assays의 신속한 설정을 가능하게 하며 좀더 쉬운 반응 최적화를 위해 다양한 템플릿 양, 샘플 유형 및 타겟 뉴클레오티드 조성에서도 충분히 신뢰할 수 있도록 설계되었다.

Product use
qPCRBIO Probe 1-Step Virus Detect 는 진단용이 아닌 연구용으로 사용되어야 한다.
그러나 모든 제품은 ISO 13485-compliant management system에서 제조되어 해당 국가의 법률이 허용하는 경우, 분석 자체의 임상 검증 후에 분자 진단의 한 방법으로 사용하기에 적합하다.

References
1. Pretorius et al., Respiratory Viral Coinfections Identified by a 10-Plex Real-Time Reverse-Transcription Polymerase Chain Reaction Assay in Patients Hospitalized With Severe Acute Respiratory Illness—South Africa, 2009–2010, The Journal of Infectious Diseases, Volume 206, Issue suppl_1, 15 December 2012, Pages S159–S165.
h t t p s : //a c a d e m i c . o u p . c o m / j i d /a r t i c l e / 2 0 6/s u p p l _1/ S159/984203

2. Corman et al. Detection of 2019 novel coronavirus (2019-nCoV) by real-time RT-PCR. Euro Surveill. 2020 Jan; 25(3):2000045.
doi: 10.2807/1560-7917.ES.2020.25.3.2000045. Erratum in: Euro Surveill. 2020 Apr; 25 (14): Erratum in: Euro Surveill. 2020 Jul; 25 (30): Erratum in: Euro Surveill. 2021 Feb;26(5): PMID: 31992387;
PMCID: PMC6988269.
h t t p s:// w w w.w h o . i n t /d o c s/d e f a u l t- s o u r c e /c o r o n a v i r u s e / protocol-v2-1.pdf

3. European Centre for Disease Prevention and Control, World Health Organization. Methods for the detection and identification of SARS-CoV-2 variants. 3 March 2021. ECDC: Stockholm; 2021.
https://www.ecdc.europa.eu/en/publications-data/methodsdetection-and-identification-sars-cov-2-variants

Related reagent

qPCRBIO 1-step-Virus-detect < 제품 상세 보기 링크



• SARS-CoV-2 및 RNA Virus 진단에 최적화
• high-throughput, highly multiplexed assays 에 이상적인 4x mix format
• Earlier detection of a wide range of template amounts
• 최대 55°C에서도 안정적인 역전사 반응을 위한 내열성 UltraScript RTase 포함
• 향상된 RNase inhibitor
• Antibody-mediated hot start technology
• 모든 Real-Time PCR 플랫폼과 호환: 표준 및 빠른 사이클링 조건

Tag
#PCR #QPCR #Taq #Sygreen #Sybr #TaqMan #molecular beacon #ECO48 #Real-Time #PCRmax #probe mix #1-step #covid #covid-19 #PCRBiosystems



전체 0