Application

Food adulteration detection using Clarity Digital PCR System

Digital PCR
작성일
2021-09-01 17:35
I. Overview

최근 저비용으로 서로 다른 종의 재료와 육류 제품을 혼합하여 식품을 만드는 일이 많아지고 있습니다.
그 결과 육류 제품에서 종의 식별은 종교적으로나 건강상의 이유 등으로 잘못 표기된 식품으로부터 소비자를 보호하기 위해 반드시 필요한 과정이 되었습니다.

이러한 불량 식품의 검출에는 단백질이나 DNA 분석 등 다양한 분석 방법이 적용 가능합니다.
이 중 중합효소연쇄반응(PCR) 기반 기술은 육류 제품에서 종의 분리에 효과가 있는 것으로 확인되고 있습니다.
본 연구에서는 Clarity system을 사용하는 디지털 PCR이 육류 샘플에서 혼합 물질의 미세한 흔적을 탐지하는 유용한 접근방식임을 보여줍니다.

II. Clarity digital PCR system detected food adulterant to a level of 0.003%

DNA 샘플은 분리된 Susscrofa (돼지고기) DNA를 Gallus gallus (닭고기) DNA에 혼합하여 조제됐으며 EvaGreen® 염료 기반 분석을 통해 분석하였습니다.
준비된 반응 혼합물이 Clarity tube strip 내의 약 10,000개의 파티션에 균일하게 분포된 다음 PCR을 통해 증폭되었습니다.

표 1에서 보듯이 최저 0.003%의 돼지고기 DNA가 검출되었고, 예측한 돼지고기 비율에 대해 얻은 데이터를 기반으로 한 그래프에서는 R2 값이 0.9909인 강한 선형 관계를 보여 Clarity system의 높은 정확도를 나타내고 있습니다.

Expected Percentage (%) Chicken Pork Measured Percentage (%)
Measured Concentration
(copies/µL)
Relative Uncertainty Measured Concentration
(copies/µL)
Relative Uncertainty
5 59.2 0.03 2.63 0.42 4.443
1 63.34 0.03 0.81 0.41 1.279
0.1 3035.03 0.06 4.6 0.02 0.152
0.05 3694.68 0.01 2.37 0.04 0.064
0.01 3583.44 0.02 0.39 0.45 0.011
0.001 3433.97 0.01 0.12 0.80 0.003
NTC 0 - 0 - 0
Table 1. Detection of spiked pork DNA using Clarity digital PCR system. The EvaGreen® dye-based digital PCR assay was designed to amplify and detect chicken and pork DNA fragments using primer sets listed in Table 2. Pork and chicken DNA were first extracted and diluted to the same concentration. Following which, pork DNA was mixed into chicken DNA to yield the following percentages of pork/chicken DNA: 5%, 1%, 0.1%, 0.05%, 0.01%, and 0.001%. The results shown are representative of two independent experiments performed in duplicates with 6 no template controls (NTC).

 

Figure 1. The plot of measured pork proportion against its expected value.


Oligonucleotide Sequence (5’-3’)
Sus scrofa (pork) Forward primer TCCTGCCCTGAGGACAAATA
Sus scrofa (pork) Reverse primer TGATGAGATTCCGGTAGGGT
Gallus gallus (chicken) Forward primer ATTCTGGGCTTAACTCTCATACT
Gallus gallus (chicken) Reverse primer GTTCGTTGTTTAGATTTGTGGAG
Table 2. List of primers used.

III. Conclusion

여기서는 Clarity digital PCR system이 qPCR보다 약 100배 더 민감한 매우 낮은 수준(0.001%)에서 대상 종을 감지할 수 있음을 입증했습니다.
Clarity 시스템의 정확성과 민감도는 육류 제품의 혼입 감지에 매우 중요합니다.
또한 식품 매개 병원체를 탐지하고 식별할 수 있는 Clarity system은 식품 안전과 소비자 건강에 직접적이고 가치 있는 영향을 미치는 유용한 분석 도구라 할 수 있습니다.

References

1. Doosti A, Ghasemi Dehkordi P, Rahimi E (2014) Molecular assay to fraud identification of meat products. J Food Sci Technol. 51:148-52.
2. Ong SB, Zuraini MI, Jurin WG, Cheah YK, Tunung R, Chai LC, Haryani Y, Ghazali FM, Son R (2007) Meat molecular detection: sensitivity of polymerase chain reaction-restriction fragment length polymorphism in species differentiation of meat from animal origin. ASEAN Food J. 14(1):51–59.

Equipment

Clarity Digital PCR system 상세 보기
Clarity Plus Digital PCR system 상세보기 


• 절대 정량
• 샘플 손실 최소화
• 정확성 향상
• 빠른 처리 시간
• 연구자만의 분석 방법 설계 가능

 

 

Application

• Cell-free nucleic acid analysis
• Quantification reference materials
• Copy number variant analysis
• Bacterial / Viral load quantification
• Next-generation sequencing (NGS) applications
• Minimum Sample Loss
• Fast Turnaround Time
• Ability to design your own assay
• SNP quantification
• Rare variant detections
• Genomic alterations
• Gene expression analysis
• Digital PCR assay customization

Tags
Food, adulteration, meat, GMO, digital PCR
전체 0